rs965953 chr1:54489474 T>G
- Sequence
gccggcagcggggggcggtgtgtg[T/G]gcgggggggtgtccaacattccca
- ASB in cell types
- ID00014 (lymphoblastoid cell, DiGeorge syndrome) foreskin keratinocyte 226LDM (normal breast luminal cells)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| ID00014 (lymphoblastoid cell, DiGeorge syndrome) | 2.11 | -2.95 | 1.50 | |||
| foreskin keratinocyte | 0.51 | n/a | 4.33 | |||
| 226LDM (normal breast luminal cells) | 2.38 | n/a | 1.00 |
Items per page:
1 – 3 of 3