rs9659735 chr1:36300311 C>T
- Sequence
cagagctaggttagaatccagact[C/T]tgctcgcttctctcacctgagcct
- ASB in cell types
- HUVEC-C (HUVEC, umbilical vein endothelial cells)
- ASB for transcription factors
- HNF4A_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| HNF4A_HUMAN | n/a | 1.99 | 1.42 | 3.42 | Concordant |
Items per page:
1 – 1 of 1
Motif analysis
Genetic associations
GRASP diabetic retinopathy in type 2 diabetes mellitus, hdl cholesterol change with statins, serum creatinine
GTEx eQTL Adipose_Visceral_Omentum, Adrenal_Gland, Artery_Aorta, Brain_Hippocampus, Colon_Transverse, Heart_Left_Ventricle, Lung, Nerve_Tibial, Pituitary, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Testis, Thyroid, Whole_Blood