rs9663057 chr1:235083146 G>C
- Sequence
gcatgtaccagtagtaaactcctg[G/C]caggaggactgcttaagcccagga
- ASB in cell types
- GM12878 (female B-cells lymphoblastoid cell line) MV-4-11 (Childhood acute monocytic leukemia) MOLM14 (Adult acute myeloid leukemia)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM12878 (female B-cells lymphoblastoid cell line) | 0.62 | 1.11 | 1.02 | |||
| MV-4-11 (Childhood acute monocytic leukemia) | 0.36 | 1.11 | 1.00 | |||
| MOLM14 (Adult acute myeloid leukemia) | 1.29 | 0.46 | 2.00 |
Items per page:
1 – 3 of 3