rs966544 chr5:173923402 A>G
- Sequence
tctctcttatctctaaagttctca[A/G]tcatttacactgacttagcttgtg
- ASB for transcription factors
- PKNX1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| PKNX1_HUMAN | 1.71 | -1.49 | 1.00 | -0.42 | Weak Concordant |
Items per page:
1 – 1 of 1
Motif analysis
Genetic associations
GRASP adiponectin levels, aortic valve calcium, body mass index (bmi), diastolic blood pressure (dbp), fasting insulin, homa-b, irritible bowel syndrome, lp-pla2 mass, systolic blood pressure (sbp), waist hip ratio