rs9666096 chr11:130798270 G>A
- Sequence
ggtttgctgagtctcgccctcata[G/A]tacctcctacttagccgttcacat
- ASB in cell types
- FaDu(Hypopharyngeal squamous cell carcinoma) HUVEC-C (HUVEC, umbilical vein endothelial cells)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| FaDu(Hypopharyngeal squamous cell carcinoma) | 2.08 | -3.48 | 1.50 | |||
| HUVEC-C (HUVEC, umbilical vein endothelial cells) | -5.11 | 2.11 | 2.50 |
Items per page:
1 – 2 of 2