rs966785 chr8:11885024 C>G
- Sequence
ggtgggaagtgaactctccctttc[C/G]taagcctgctggagttcattctct
- ASB in cell types
- HepG2 (hepatoblastoma)
- ASB for transcription factors
- P66A_HUMAN CEBPA_HUMAN CREB1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| P66A_HUMAN | -3.41 | 3.30 | 1.00 | n/a | n/a | |||
| CEBPA_HUMAN | -3.88 | 2.27 | 1.50 | 1.71 | Weak Concordant | |||
| CREB1_HUMAN | -0.49 | 1.59 | 1.17 | n/a | No Hit |
Items per page:
1 – 3 of 3
Motif analysis
Genetic associations
GRASP chronic kidney disease, diastolic blood pressure (dbp), height, parkinsons disease, serum creatinine, triglycerides
GTEx eQTL Artery_Aorta, Artery_Tibial, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Cells_Cultured_fibroblasts, Esophagus_Mucosa, Esophagus_Muscularis, Heart_Atrial_Appendage, Muscle_Skeletal, Nerve_Tibial, Pancreas, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Stomach, Testis, Thyroid, Whole_Blood