rs9668141 chr12:8396789 C>G
- Sequence
ggcggcgcgggctcctccgcgggc[C/G]gctcgtggtcctctggcgccctct
- ASB in cell types
- glioblastoma cells GM12891 (male B- cells lymphoblastoid cell line) spleen IPSC-derived bipolar neuron
- ASB for transcription factors
- CTCF_HUMAN STAG1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 1.16 | 0.17 | 1.31 | -2.06 | Concordant | |||
| STAG1_HUMAN | 0.81 | -0.04 | 1.30 | n/a | n/a |
Items per page:
1 – 2 of 2
Motif analysis
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Brain_Anterior_cingulate_cortex_BA24, Brain_Cortex, Brain_Frontal_Cortex_BA9, Colon_Transverse, Lung, Nerve_Tibial, Pituitary, Spleen, Testis, Whole_Blood