rs9668701 chr12:8396905 T>C
- Sequence
caggaggtcgctgtcccttgcccg[T/C]ggccaggcccgctctggccaggcc
- ASB in cell types
- GM23338 MCF7L-P(immortalized breast epithelial cell line) HCT-116-RAD21-mAC Kelly (neuroblastoma)
- ASB for transcription factors
- CTCF_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 1.23 | 0.24 | 1.36 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Brain_Anterior_cingulate_cortex_BA24, Brain_Cortex, Brain_Frontal_Cortex_BA9, Colon_Transverse, Lung, Nerve_Tibial, Pituitary, Spleen, Testis, Thyroid, Whole_Blood