rs9671394 chr14:100693337 C>T
- Sequence
cacatgctgagcactcaggaagtg[C/T]gtgctgaatgagtaaacgagtgaa
- ASB in cell types
- HEK293 (embryonic kidney) SYO-1(Biphasic synovial sarcoma)
- ASB for transcription factors
- ZN629_HUMAN SSXT_HUMAN GLIS2_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ZN629_HUMAN | 3.07 | n/a | 2.00 | n/a | n/a | |||
| SSXT_HUMAN | 1.51 | -0.30 | 1.00 | n/a | n/a | |||
| GLIS2_HUMAN | 2.79 | -5.12 | 2.00 | n/a | No Hit |
Items per page:
1 – 3 of 3
Motif analysis
No data available
Genetic associations
GRASP cystatin c in serum, diastolic blood pressure (dbp), hdl cholesterol, obesity with early age of onset (age >2), rheumatoid arthritis, salmonella-induced pyroptosis, systolic blood pressure (sbp)