rs9672398 chr15:53587044 T>G
- Sequence
tgcccaagtgagggactgggtttc[T/G]caatgattgtagagacactttatt
- ASB in cell types
- MOLM-13(acute monocytic leukemia(AML), Homo sapiens) upper lobe of left lung foreskin keratinocyte MM1.S (plasma cell myeloma)
- ASB for transcription factors
- CTCF_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 0.71 | 1.03 | 1.30 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP chronic kidney disease, fasting insulin, hdl cholesterol, hypertension, combined control dataset, lp-pla2 activity, neuroblastoma (brain cancer), serum creatinine, transmission distortion, triglycerides, triglycerides change with statins, waist hip ratio