rs967420 chr14:81710599 A>T
- Sequence
aatacaatgtattgctgtttctca[A/T]tgattctcacaacacatggaagat
- ASB in cell types
- GM18505 (female B-cells Lymphoblastoid Cell Lines) foreskin keratinocyte right lobe of liver
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM18505 (female B-cells Lymphoblastoid Cell Lines) | 1.39 | -1.07 | 1.00 | |||
| foreskin keratinocyte | -3.57 | 2.70 | 2.83 | |||
| right lobe of liver | 2.17 | n/a | 1.00 |
Items per page:
1 – 3 of 3