rs9674272 chr16:84622402 G>A
- Sequence
ttgctgtccatttgcccagctaaa[G/A]gagaaaaataaacctcatatcaga
- ASB in cell types
- GM12878 (female B-cells lymphoblastoid cell line) A549 (lung carcinoma) HCT-116 (colon carcinoma) CD34+ stem cells-derived erythroblasts
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM12878 (female B-cells lymphoblastoid cell line) | 0.76 | 0.52 | 1.13 | |||
| A549 (lung carcinoma) | 0.98 | 0.18 | 2.00 | |||
| HCT-116 (colon carcinoma) | 1.37 | 0.06 | 2.00 | |||
| CD34+ stem cells-derived erythroblasts | 2.18 | 0.32 | 2.00 | |||
| neutrophils from periferal blood | 1.88 | -0.04 | 2.00 |
Items per page:
1 – 5 of 5