rs967530 chr1:39130465 T>A
- Sequence
ttggtttctactcctttctctgtt[T/A]tcagataaatcctcctacatgtcc
- ASB in cell types
- BIN-67 (Ovarian small cell carcinoma, hypercalcemic type) K562 (myelogenous leukemia)
- ASB for transcription factors
- IKZF1_HUMAN SOX6_HUMAN SMRC1_HUMAN ARI1B_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| IKZF1_HUMAN | -2.00 | 2.34 | 1.25 | n/a | n/a | |||
| SOX6_HUMAN | -2.41 | 2.65 | 1.00 | n/a | No Hit | |||
| SMRC1_HUMAN | 0.39 | 1.72 | 1.00 | n/a | n/a | |||
| ARI1B_HUMAN | -2.24 | 2.60 | 1.00 | n/a | n/a |
Items per page:
1 – 4 of 4
Motif analysis
No data available
Genetic associations
GRASP diastolic blood pressure (dbp), fasting blood glucose, fasting insulin, hdl cholesterol, homa-ir, systolic blood pressure (sbp), triglycerides
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Artery_Aorta, Artery_Tibial, Brain_Cerebellar_Hemisphere, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Colon_Sigmoid, Colon_Transverse, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Esophagus_Muscularis, Heart_Atrial_Appendage, Heart_Left_Ventricle, Lung, Muscle_Skeletal, Nerve_Tibial, Pancreas, Pituitary, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Spleen, Testis, Thyroid, Whole_Blood