rs9675320 chr17:40542414 T>C
- Sequence
ccaactgctgagagcacaccctcc[T/C]ctagcagccagaaatcatctgtta
- ASB in cell types
- HUVEC-C (HUVEC, umbilical vein endothelial cells)
- ASB for transcription factors
- TF65_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| TF65_HUMAN | 1.85 | -0.38 | 2.33 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP alzheimers disease, alzheimers disease (apoe4 positive), barnes akathisia rating scale, obesity with early age of onset (age >2), salmonella-induced pyroptosis, schizophrenia, tardive dyskinesia