rs9677411 chr2:195596047 A>C
- Sequence
gccgataagacatctggatcaagc[A/C]cactgaggaactgggaagagacag
- ASB in cell types
- HUDEP-2 (Human Umbilical Cord Blood-Derived Erythroid Progenitor Cells-2) MDM(monocyte derived macrophages)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HUDEP-2 (Human Umbilical Cord Blood-Derived Erythroid Progenitor Cells-2) | 1.68 | -1.43 | 1.50 | |||
| MDM(monocyte derived macrophages) | 1.31 | -1.31 | 1.67 |
Items per page:
1 – 2 of 2