rs968388 chr19:49818255 C>G
- Sequence
ccagcagccctaaaccgcccgacg[C/G]gagcgcgcgcgcggcgcaggcgca
- ASB in cell types
- K562 (myelogenous leukemia) HEK293 (embryonic kidney) neutrophils primary B-CLL cells
- ASB for transcription factors
- IKZF1_HUMAN CREB1_HUMAN NFIC_HUMAN NCOA6_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| IKZF1_HUMAN | 0.15 | 1.72 | 1.50 | n/a | n/a | |||
| CREB1_HUMAN | 1.33 | 0.30 | 1.59 | n/a | No Hit | |||
| NFIC_HUMAN | n/a | 2.06 | 2.00 | n/a | No Hit | |||
| NCOA6_HUMAN | n/a | 3.22 | 2.00 | n/a | n/a | |||
| BRD4_HUMAN | 2.16 | 1.75 | 1.56 | n/a | n/a |
Items per page:
1 – 5 of 5
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Artery_Aorta, Artery_Tibial, Brain_Caudate_basal_ganglia, Brain_Cortex, Brain_Frontal_Cortex_BA9, Cells_Cultured_fibroblasts, Colon_Sigmoid, Colon_Transverse, Esophagus_Mucosa, Esophagus_Muscularis, Muscle_Skeletal, Nerve_Tibial, Pancreas, Pituitary, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Stomach, Testis, Thyroid, Whole_Blood