rs9685849 chr4:122667163 C>G
- Sequence
ttactagaaaaggggttggccaac[C/G]tattgattcatcctggacggatgc
- ASB in cell types
- 22RV1 (prostate carcinoma) BEAS-2B (bronchial epithelium)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| 22RV1 (prostate carcinoma) | 2.88 | -5.39 | 2.00 | |||
| BEAS-2B (bronchial epithelium) | 0.35 | 1.10 | 1.00 |
Items per page:
1 – 2 of 2