rs9686661 chr5:56565959 C>T
- Sequence
gccaagatcactctgccctgcacc[C/T]tcctcttttcttcaagggattagg
- ASB in cell types
- monocyte-derived dendritic cells SEM (childhood B acute lymphoblastic leukemia)
- ASB for transcription factors
- SPI1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| SPI1_HUMAN | -0.23 | 1.76 | 1.76 | 4.96 | Concordant |
Items per page:
1 – 1 of 1
Motif analysis
Genetic associations
EMBL-EBI high density lipoprotein cholesterol levels, triglyceride levels, triglycerides, type 2 diabetes
GRASP advanced age-related macular degeneration, college completion, coronary artery disease (cad), hdl cholesterol, infant head circumference, ldl cholesterol, total cholesterol, triglycerides, waist hip ratio