rs968746 chr20:9515779 T>C
- Sequence
ctgcatggggattccagcttgtaa[T/C]gccttctgttcccctgcctgcttt
- ASB in cell types
- HDF(human dermal fibroblasts)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HDF(human dermal fibroblasts) | 2.21 | -1.89 | 1.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Visceral_Omentum, Artery_Aorta, Artery_Tibial, Breast_Mammary_Tissue, Lung, Ovary, Spleen, Thyroid, Vagina