rs9687846 chr5:56566067 G>A
- Sequence
gcactgatttatgtgcaatgcaca[G/A]gacagacaaaattgctcccttcat
- ASB in cell types
- SEM (childhood B acute lymphoblastic leukemia)
- ASB for transcription factors
- SPI1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| SPI1_HUMAN | -0.57 | 1.63 | 1.87 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
EMBL-EBI waist-to-hip ratio adjusted for bmi, waist-to-hip ratio adjusted for bmi (adjusted for smoking behaviour), waist-to-hip ratio adjusted for bmi (age <50), waist-to-hip ratio adjusted for bmi x sex x age interaction (4df test), waist-to-hip ratio adjusted for body mass index
GRASP advanced age-related macular degeneration, coronary artery disease (cad), hdl cholesterol, infant head circumference, ldl cholesterol, total cholesterol, triglycerides, waist hip ratio