rs9694958 chr8:42298528 A>G
- Sequence
attgtggatcttctgactggttcc[A/G]ttgcatgcatccatctgactgaag
- ASB in cell types
- breast tumor
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| breast tumor | 2.11 | n/a | 2.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP alzheimers disease, ldl cholesterol, partial epilepsy, stabilized warfarin dose, tetrology of fallot, years of education
GTEx eQTL Adipose_Subcutaneous, Adrenal_Gland, Artery_Tibial, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Cells_Cultured_fibroblasts, Esophagus_Mucosa, Heart_Atrial_Appendage, Lung, Muscle_Skeletal, Nerve_Tibial, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Testis