rs9695394 chr9:19136368 C>A
- Sequence
agcttttcacctctctgaggcgct[C/A]cccagccctaaatcataaactagt
- ASB in cell types
- MCF7 (Invasive ductal breast carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| MCF7 (Invasive ductal breast carcinoma) | -2.24 | 2.50 | 1.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP age at death with kuru exposure, diastolic blood pressure (dbp), hypertriglyceridemia, ldl cholesterol, salmonella-induced pyroptosis, total cholesterol