rs969564 chr15:39247600 T>C
- Sequence
ctgtaatatctgaattttattcct[T/C]tctttccaaatttggggaaaaaaa
- ASB in cell types
- GM23248
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM23248 | 1.97 | -1.41 | 1.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration (geographic atrophy), aortic valve calcium, chronic kidney disease, diastolic blood pressure (dbp), maternal transmission distortion, premature ovarian failure, refractive error, systolic blood pressure (sbp), triglycerides change with statins