rs9696126 chr9:110147856 C>T
- Sequence
agttgtgagcctgaaataaataac[C/T]gaacacacatgataaaattgcttt
- ASB in cell types
- GM12878 (female B-cells lymphoblastoid cell line)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM12878 (female B-cells lymphoblastoid cell line) | 0.85 | 0.15 | 1.09 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration (choroidal neovascularization) vs. no amd, child behavior checklist dysregulation profile in children with attention deficit/hyperactivity disorder (adhd), hypertension (early onset hypertension), maternal transmission distortion, serum creatinine, triglycerides, waist hip ratio