rs970096 chr4:174214473 A>G
- Sequence
gtcgcggaggagaggaactggaaa[A/G]tgggaaataggtgtctgctgacct
- ASB in cell types
- GM23338
- ASB for transcription factors
- EZH2_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| EZH2_HUMAN | 1.19 | -0.22 | 1.05 | n/a | n/a |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration (choroidal neovascularization) vs. no amd, amyotrophic lateral sclerosis (als), triglycerides change with statins
GTEx eQTL Adipose_Visceral_Omentum, Artery_Tibial, Colon_Transverse, Esophagus_Gastroesophageal_Junction, Esophagus_Muscularis, Nerve_Tibial, Thyroid