rs971173 chr1:113905292 G>T
- Sequence
agctgcggcgggcaatcggaaatc[G/T]gctactttggcctgtctcctccct
- ASB in cell types
- MCF7 (Invasive ductal breast carcinoma) MCF7L-P(immortalized breast epithelial cell line) neutrophils from periferal blood erythroid cells
- ASB for transcription factors
- CTCF_HUMAN CTCFL_HUMAN MYC_HUMAN HDAC1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 1.65 | 0.90 | 1.56 | n/a | No Hit | |||
| CTCFL_HUMAN | 2.90 | -4.33 | 2.00 | n/a | No Hit | |||
| MYC_HUMAN | 2.08 | 0.35 | 2.45 | n/a | No Hit | |||
| HDAC1_HUMAN | 2.58 | -0.18 | 1.83 | n/a | n/a | |||
| KDM6A_HUMAN | 2.19 | -0.03 | 1.75 | n/a | n/a |
Items per page:
1 – 5 of 9
Motif analysis
Genetic associations
GRASP acute lung injury following major trauma, advanced age-related macular degeneration, childhood acute lymphoblastic leukemia, chronic kidney disease, irritible bowel syndrome, psoriasis and/or psoriatic arthritis, psoriasis only (no arthritis), psoriatic arthritis, rheumatoid arthritis, salmonella-induced pyroptosis, schizophrenia, serum creatinine, stabilized warfarin dose, total cholesterol change with statins
GTEx eQTL Adipose_Subcutaneous, Artery_Tibial, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Colon_Sigmoid, Esophagus_Gastroesophageal_Junction, Esophagus_Muscularis, Muscle_Skeletal, Nerve_Tibial, Skin_Not_Sun_Exposed_Suprapubic, Spleen, Testis, Thyroid, Whole_Blood