rs971398 chr8:94206351 C>T
- Sequence
gtgtgtctttctttggataatcaa[C/T]gagcagttacagaacaactagccc
- ASB in cell types
- foreskin keratinocyte bipolar neuron IPSC-derived bipolar neuron
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| foreskin keratinocyte | 2.11 | 0.19 | 2.00 | |||
| bipolar neuron | -1.47 | 1.47 | 1.00 | |||
| IPSC-derived bipolar neuron | 0.18 | 1.99 | 1.00 |
Items per page:
1 – 3 of 3
Motif analysis
No data available
Genetic associations
GRASP breast cancer early age of onset (diagnosed before age 40), late onset alzheimers disease, waist hip ratio