rs971833 chr4:35227008 A>T
- Sequence
tggagataaaagtctatgaatgtt[A/T]gctttttttttttttgactagtct
- ASB in cell types
- MCF7 (Invasive ductal breast carcinoma)
- ASB for transcription factors
- FOXA1_HUMAN GATA3_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| FOXA1_HUMAN | -0.56 | 1.94 | 2.40 | 5.79 | Concordant | |||
| GATA3_HUMAN | 0.15 | 2.62 | 2.00 | -3.59 | Discordant |
Items per page:
1 – 2 of 2
Motif analysis
Genetic associations
GRASP advanced age-related macular degeneration (geographic atrophy), diastolic blood pressure (dbp)