rs971891 chr5:130237973 C>T
- Sequence
ctgagtggtacttttccctgtcca[C/T]gcacttaaattttaatgtagggaa
- ASB in cell types
- HUVEC-C (HUVEC, umbilical vein endothelial cells) macrophages form periferal blood
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HUVEC-C (HUVEC, umbilical vein endothelial cells) | 1.03 | -0.64 | 1.86 | |||
| macrophages form periferal blood | 1.61 | -0.56 | 2.00 |
Items per page:
1 – 2 of 2