rs9719152 chr7:139672834 G>A
- Sequence
agaatcatagtttatttaatcatc[G/A]caggttgtcttctacatgactacc
- ASB in cell types
- GM12878 (female B-cells lymphoblastoid cell line) LHSAR (prostate epithelial cells)
- ASB for transcription factors
- HTF4_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| HTF4_HUMAN | 2.33 | -2.00 | 1.00 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP age at death with kuru exposure, comorbid depressive syndrome and alcohol dependence, variant creutzfeldt-jakob disease, waist hip ratio