rs972259 chr6:40233107 C>T
- Sequence
tgcttttctgcttctggtctttct[C/T]agaagctatggaacttagcccatg
- ASB in cell types
- GM12878 (female B-cells lymphoblastoid cell line)
- ASB for transcription factors
- IKZF1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| IKZF1_HUMAN | -1.32 | 2.23 | 1.25 | n/a | n/a |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP diastolic blood pressure (dbp), suicide attempts in bipolar disorder (males), triglycerides change with statins, variant creutzfeldt-jakob disease