rs972433 chr8:18697288 G>A
- Sequence
gggtatcacaggcaagggggagag[G/A]gtaggaaacaacgggctaagaatg
- ASB in cell types
- GM02610 (Lymphoblastoid Cell Lines) heart left ventricle
- ASB for transcription factors
- CTCF_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 2.15 | 0.17 | 1.17 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration, advanced age-related macular degeneration (choroidal neovascularization) vs. no amd, aortic valve calcium, obesity with early age of onset (age >2), refractive error