rs972798 chr12:11721761 A>G
- Sequence
taagcaaggtaatatttataagac[A/G]tccagcagagggtctggcaccctg
- ASB in cell types
- MS-1 (Small cell lung carcinoma)
- ASB for transcription factors
- CTCF_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | -0.39 | 2.47 | 1.00 | 1.01 | Weak Concordant |
Items per page:
1 – 1 of 1
Motif analysis
Genetic associations
GRASP age-related macular degeneration, autism, autism with low iq, height, plasma aldosterone concentration corrected by plasma renin activity