rs9728951 chr1:19014898 G>T
- Sequence
ttggcccagtcctcttccctattt[G/T]aaggcttcttcctaagaagtcatt
- ASB in cell types
- monocyte-derived dendritic cells
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| monocyte-derived dendritic cells | 1.72 | -4.37 | 2.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Artery_Tibial, Brain_Frontal_Cortex_BA9, Cells_Cultured_fibroblasts, Skin_Not_Sun_Exposed_Suprapubic, Thyroid