rs973237 chr10:61765543 G>A
- Sequence
gatctcatttagaatgtattacac[G/A]ggagacacagacatccattgcaga
- ASB for transcription factors
- ETS1_HUMAN SMCA4_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ETS1_HUMAN | 0.06 | 2.20 | 1.00 | n/a | No Hit | |||
| SMCA4_HUMAN | 1.17 | -0.05 | 1.00 | n/a | n/a |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration, advanced age-related macular degeneration (choroidal neovascularization) vs. no amd, bipolar disorder, body mass index (bmi), coronary artery disease (cad), diastolic blood pressure (dbp), hypertension (early onset hypertension), ldl cholesterol, rheumatoid arthritis, systolic blood pressure (sbp)