rs974471 chr14:29216122 G>A
- Sequence
gcttagggaattaatgggtgatgt[G/A]taatacaccacaaaggtatctgtc
- ASB in cell types
- HUVEC-C (HUVEC, umbilical vein endothelial cells)
- ASB for transcription factors
- SMC3_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| SMC3_HUMAN | -1.66 | 2.04 | 1.00 | n/a | n/a |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
EMBL-EBI body mass index, body mass index (joint analysis main effects and physical activity interaction), body mass index in physically active individuals, cognitive ability (mtag), intelligence (mtag)
GRASP 2 hour glucose, arthritis including non-rheumatoid, body mass index (bmi), homa-b, microalbuminuria, rheumatoid arthritis, urinary albumin-to-creatinine ratio