rs974559 chr20:38962718 T>C
- Sequence
gagatggggaatcctaaagctccc[T/C]ctcgtgtctcgttagcgccctggg
- ASB in cell types
- K562 (myelogenous leukemia) GM18505 (female B-cells Lymphoblastoid Cell Lines) GM19193 (female B-cells Lymphoblastoid Cell Lines) upper lobe of left lung
- ASB for transcription factors
- CTCF_HUMAN STAG1_HUMAN ARNT_HUMAN COT1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 0.64 | 1.12 | 1.38 | 0.83 | Weak Concordant | |||
| STAG1_HUMAN | -0.54 | 1.53 | 1.25 | n/a | n/a | |||
| ARNT_HUMAN | -0.90 | 2.35 | 2.00 | n/a | No Hit | |||
| COT1_HUMAN | -4.70 | 2.60 | 2.00 | n/a | No Hit | |||
| MGAP_HUMAN | n/a | 2.58 | 2.00 | 2.66 | Concordant |
Items per page:
1 – 5 of 7
Motif analysis
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Artery_Aorta, Artery_Coronary, Artery_Tibial, Brain_Cortex, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Colon_Sigmoid, Colon_Transverse, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Esophagus_Muscularis, Heart_Atrial_Appendage, Lung, Nerve_Tibial, Prostate, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Spleen, Stomach, Testis, Thyroid, Whole_Blood