rs9769403 chr7:105522644 G>A
- Sequence
acatttgatcctgggaatgtagtg[G/A]atctaaaagcaccatcttcctact
- ASB in cell types
- K562 (myelogenous leukemia) MCF7 (Invasive ductal breast carcinoma)
- ASB for transcription factors
- ESR1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ESR1_HUMAN | -0.73 | 1.78 | 1.00 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP infant head circumference, stabilized warfarin dose, tetrology of fallot, urinary albumin-to-creatinine ratio
GTEx eQTL Adipose_Subcutaneous, Adrenal_Gland, Artery_Tibial, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Cells_Cultured_fibroblasts, Colon_Sigmoid, Esophagus_Gastroesophageal_Junction, Esophagus_Muscularis, Lung, Muscle_Skeletal, Nerve_Tibial, Pituitary, Prostate, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Thyroid