rs977041 chr2:229486132 G>A
- Sequence
gcactctgaggcaagaagtaaacc[G/A]ggggaataaatagtgcaccatcaa
- ASB in cell types
- germinal center B-cells
- ASB for transcription factors
- MEF2B_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| MEF2B_HUMAN | -4.71 | 2.19 | 2.00 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration (geographic atrophy), chronic kidney disease, diastolic blood pressure (dbp), ldl cholesterol, serum creatinine