rs9785050 chr7:25259786 A>T
- Sequence
aaaaattgctgccctagaagcgag[A/T]ggaaggcgtcctggtgtgtaaaag
- ASB in cell types
- HeLa Kyoto (cervical adenocarcinoma) tibial artery HUVEC-C (HUVEC, umbilical vein endothelial cells) transverse colon
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HeLa Kyoto (cervical adenocarcinoma) | 1.63 | -0.37 | 2.00 | |||
| tibial artery | -1.78 | 2.05 | 1.00 | |||
| HUVEC-C (HUVEC, umbilical vein endothelial cells) | 1.68 | -0.65 | 1.00 | |||
| transverse colon | -0.22 | 1.30 | 1.00 | |||
| esophagus squamous epithelium | -0.39 | 1.53 | 1.00 |
Items per page:
1 – 5 of 12
Motif analysis
No data available
Genetic associations
GRASP diabetic retinopathy in type 2 diabetes mellitus, fasting blood glucose, homa-ir, obesity with early age of onset (age >2)