rs9787810 chr11:64317826 C>T
- Sequence
aaatagctgcaatgcaggagctct[C/T]gttgaatgcaaaataaacacattt
- ASB in cell types
- K562 (myelogenous leukemia) primary B-CLL cells GM12878 (female B-cells lymphoblastoid cell line) VCaP (prostate carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | 0.34 | 0.89 | 2.01 | |||
| primary B-CLL cells | 1.75 | n/a | 3.00 | |||
| GM12878 (female B-cells lymphoblastoid cell line) | 0.76 | 0.90 | 1.06 | |||
| VCaP (prostate carcinoma) | 1.26 | 0.47 | 4.62 |
Items per page:
1 – 4 of 4
Motif analysis
No data available
Genetic associations
GRASP adiponectin levels, fasting blood glucose, hdl cholesterol, hypertension (early onset hypertension), irritible bowel syndrome, platelet count, rheumatoid arthritis, stabilized warfarin dose
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Adrenal_Gland, Artery_Tibial, Brain_Caudate_basal_ganglia, Brain_Cerebellum, Brain_Cortex, Brain_Frontal_Cortex_BA9, Brain_Hypothalamus, Brain_Nucleus_accumbens_basal_ganglia, Brain_Putamen_basal_ganglia, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Colon_Sigmoid, Colon_Transverse, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Esophagus_Muscularis, Heart_Atrial_Appendage, Heart_Left_Ventricle, Lung, Muscle_Skeletal, Nerve_Tibial, Ovary, Pituitary, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Small_Intestine_Terminal_Ileum, Spleen, Testis, Thyroid, Whole_Blood