rs978809 chr22:32776239 T>G
- Sequence
cgacaccctttttttttcagccca[T/G]tgagaccagtttgggacttctggc
- ASB in cell types
- foreskin keratinocyte IPSC-derived bipolar neuron
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| foreskin keratinocyte | n/a | 2.97 | 3.00 | |||
| IPSC-derived bipolar neuron | -1.34 | 1.70 | 1.00 |
Items per page:
1 – 2 of 2