rs9788614 chr14:22375455 G>T
- Sequence
ataaccaagatctcttatagaaat[G/T]ctcataaagcaacaggtggaacat
- ASB in cell types
- A549 (lung carcinoma) glioblastoma patient-derived cell model GM12890 (Lymphoblastoid Cell Lines) neural progenitors
- ASB for transcription factors
- SMC3_HUMAN RAD21_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| SMC3_HUMAN | 1.36 | 0.94 | 1.93 | n/a | n/a | |||
| RAD21_HUMAN | 1.22 | 0.37 | 1.79 | n/a | n/a |
Items per page:
1 – 2 of 2