rs979013 chr12:53927021 C>A
- Sequence
attacaagaagagtttgactattt[C/A]taataatcattaaaaaacacccgc
- ASB in cell types
- TTC-1240 (Rhabdoid tumor of the kidney)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| TTC-1240 (Rhabdoid tumor of the kidney) | -0.79 | 1.55 | 1.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP all antimetabolite drugs-induced neutropenia/leukopenia in cancer patients, college completion, ldl cholesterol, total cholesterol, waist hip ratio, years of education
GTEx eQTL Artery_Tibial, Cells_Cultured_fibroblasts, Muscle_Skeletal, Prostate, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg