rs9791109 chr5:38383289 C>T
- Sequence
aatgctgtgtcaaaatgatgcaaa[C/T]aactggtacatacatttctttcca
- ASB in cell types
- GM02610 (Lymphoblastoid Cell Lines) BT-474 (breast invasive ductal carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM02610 (Lymphoblastoid Cell Lines) | 1.97 | -1.66 | 1.00 | |||
| BT-474 (breast invasive ductal carcinoma) | 0.32 | 2.14 | 1.20 |
Items per page:
1 – 2 of 2