rs9791151 chr5:149498235 T>G
- Sequence
ttatgcatatatgccccttttttt[T/G]tttgggaaataatagcgaacatac
- ASB in cell types
- 22RV1 (prostate carcinoma)
- ASB for transcription factors
- ANDR_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ANDR_HUMAN | 2.09 | -0.65 | 2.00 | 2.28 | Discordant |
Items per page:
1 – 1 of 1
Motif analysis
