rs9791245 chr6:11323667 A>T
- Sequence
tgttcatggtttcaaggctgaaaa[A/T]cactgctctaagctaatgcagaag
- ASB in cell types
- neutrophils from periferal blood
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| neutrophils from periferal blood | 1.27 | -0.14 | 1.50 |
Items per page:
1 – 1 of 1