rs979194 chr4:142615430 T>C
- Sequence
tggttaaaggagtaaagctttgtc[T/C]acaaatttggagtcagcagaaagg
- ASB in cell types
- MCF7 (Invasive ductal breast carcinoma) MCF7L-P(immortalized breast epithelial cell line)
- ASB for transcription factors
- ESR1_HUMAN GATA3_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ESR1_HUMAN | 1.33 | 0.35 | 1.88 | n/a | No Hit | |||
| GATA3_HUMAN | 1.15 | -0.20 | 2.00 | n/a | No Hit |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP hdl cholesterol change with statins, height, rheumatoid arthritis, triglycerides change with statins