rs9792558 chr9:117807917 T>C
- Sequence
atgtcctgatttacaaagagaaaa[T/C]tagttcacctgaatgacaaggttt
- ASB for transcription factors
- RARA_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| RARA_HUMAN | 1.67 | -0.37 | 1.00 | 0.26 | Weak Discordant |
Items per page:
1 – 1 of 1
Motif analysis
Genetic associations
GRASP 2 hour glucose, mitral annular calcium, obesity with early age of onset (age >2), urinary albumin-to-creatinine ratio, years of education