rs9793263 chr1:46256717 A>G
- Sequence
acaaaagcatttgagttttttgcc[A/G]actttgcctttatgttatgttatt
- ASB in cell types
- K562 (myelogenous leukemia)
- ASB for transcription factors
- ZN316_HUMAN EMSY_HUMAN MAFG_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ZN316_HUMAN | n/a | 4.98 | 1.00 | n/a | No Hit | |||
| EMSY_HUMAN | -3.05 | 3.21 | 1.00 | n/a | n/a | |||
| MAFG_HUMAN | n/a | 2.76 | 1.00 | 4.03 | Concordant |
Items per page:
1 – 3 of 3
Motif analysis
Genetic associations
GRASP adiponectin levels, asthma, coronary artery disease (cad), ldl cholesterol, obesity with early age of onset (age >2), stabilized warfarin dose, tetrology of fallot, total cholesterol, years of education
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Adrenal_Gland, Artery_Aorta, Artery_Tibial, Brain_Caudate_basal_ganglia, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Brain_Cortex, Brain_Nucleus_accumbens_basal_ganglia, Brain_Putamen_basal_ganglia, Brain_Spinal_cord_cervical_c-1, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Cells_EBV-transformed_lymphocytes, Colon_Transverse, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Esophagus_Muscularis, Heart_Left_Ventricle, Lung, Minor_Salivary_Gland, Muscle_Skeletal, Nerve_Tibial, Pancreas, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Spleen, Stomach, Testis, Thyroid, Whole_Blood